Ontario to Florida · Vermont to TexasWherever white mulberry grows alongside
Morus alba × Morus rubra · eastern North America
The native tree at risk of disappearing into its invader
The truth is in there
Red mulberry is being cut down and crowded out, and it is also being absorbed: it hybridises with the introduced white mulberry that grows alongside it, and each generation carries more white mulberry ancestry. In four studied populations in southern Ontario, more than half of the trees were already hybrids.1 Many of them can pass for red mulberry.
The practical question is how you would know whether a particular tree, stand or batch of seedlings is affected. Two things limit what any method can detect: how the marker is inherited, and how many generations of backcrossing have happened. If you ignore them, you can pay for a test that cannot answer your question.
This page covers, in order: what you can tell by eye, and where that stops; what limits every molecular test; the markers that already exist, and why none is validated for this problem yet; and two new markers derived here from 45 published chloroplast genomes and 180 published gene sequences, one maternal and one biparental, both readable on a strip of agarose. It ends with how to choose a method and how many trees to test.
Once you have DNA, telling pure red mulberry from pure white is easy, cheap and definitive. The species differ at many fixed positions, and one sequencing read settles it. Catching a recent hybrid is nearly as easy. Sequence ITS, a region both parents contribute to, and a hybrid shows both parents' bases superimposed at the diagnostic sites. Neither pure species can produce that pattern. Add one chloroplast read to trace the maternal line. Two reactions, a few dollars each in reagents.
No cheap test can prove that a red-looking tree carries no white ancestry. A tree several generations into backcrossing can look and sequence as pure red at any one marker. Ruling that out takes genome-wide data compared against verified pure-parent trees, and no validated set of those reference trees exists yet for this species pair.
In short: red, white or recent hybrid can be shown cheaply. Freedom from all white ancestry cannot be shown by any test you can buy today.
If you only want to identify a tree, start with the field character table in File 02.
Substantive claims below carry one of these tags. Computed here means it was calculated from public sequence data and can be reproduced from the accessions given. Unverified means I could not confirm it against a source, so don't rely on it.
Southern OntarioFour populations · 184 trees · 2005
File 01 · The disappearanceA tree can go extinct without anything dying
Red mulberry (Morus rubra) is native to eastern North America, from Ontario and Vermont south to Florida and west to Texas and South Dakota. White mulberry (Morus alba) was brought from Asia for silkworm culture and is now one of the commonest weedy trees on the continent.
The two species hybridise readily, and the hybrids are fertile. Where they grow together, the hybrids carry more white mulberry ancestry than red, and the bias is stronger where white mulberry is more common. Each generation of backcrossing dilutes the native genome further. No tree dies; the end state is a stand whose red mulberry ancestry survives only as fragments in genomes that are increasingly white mulberry.
The measurement everyone cites comes from Burgess, Morgan, Deverno and Husband, published in Molecular Ecology in 2005.1 They genotyped 184 trees from four populations in southern Ontario where both species grow together, using nuclear markers alongside chloroplast sequence.
| Measure | Value |
|---|---|
| Classified as hybrids (RAPD index) | 53% (98 of 184) |
| Classified as red mulberry | 29% (53) |
| Classified as white mulberry | 18% (33) |
| Range of hybrid frequency across the four sites | 43% – 67% |
| Hybrids with more white than red mulberry markers | 67% |
| Hybrids carrying a white mulberry chloroplast | 68% of 25 |
43 polymorphic RAPD fragments — of which only nine were species-diagnostic, five for white mulberry and four for red — plus chloroplast sequence from an 802 bp window of rbcL, in which the two species differ at just three fixed sites.1 Sampling was stratified: every putative red mulberry was taken, along with a roughly 25% subsample of the putative white and hybrid trees within 25 m of each. The authors note this may overestimate hybrid frequency and underestimate white.1 The paper's abstract gives the hybrid count as 53.7% (n = 99) while its results section and Figure 3 give 53% (n = 98); 53 + 33 + 98 = 184, so the figures here follow the results section. The widely quoted "53.7%" comes from the abstract.
The last line matters most for what follows. Put the other way round, 32% of those hybrids carried a red mulberry chloroplast. That is why no chloroplast test, including the one derived below, can be enough on its own.
Not very. The chloroplast result rests on 25 hybrids, not 184; only 42 trees were sequenced in total. Seventeen of the 25 carried the white mulberry chloroplast type. Burgess and colleagues tested that split against 1:1 and could not reject it (χ² = 2.72, P = 0.099), which is why their own discussion says most hybrids carried the white chloroplast type "although insignificantly".1
The confidence interval is wide. The fraction of hybrids with a red-type chloroplast (the ones a chloroplast test cannot see) lies between 17% and 52% at 95% confidence. computed here The point estimate is a third. The upper end is half.
This page uses "about a third" as the best available estimate; it could be as high as half. Where a conclusion depends on the difference, that is flagged.
Michigan lists red mulberry as state threatened.2 In Ontario, where the species sits at its northern range edge and hybridisation pressure is worst, most known red mulberry sites have white mulberry growing in them.2
A red mulberry that is genetically half white mulberry still fruits, still feeds birds, and still counts as a native tree in a plant survey. Without a test the loss is invisible, so every estimate of how much red mulberry is left depends on how the trees were identified. Nobody is systematically screening the trees in any given county, and looking at them is not enough.
The rest of this page asks which test to use, and what it will settle. The options are more limited than they first appear, so it is worth understanding them before you spend anything.
Eastern North AmericaMature leaves, ordinary shoots
File 02 · The suspectsWhat you can actually see from the ground
The two pure species can be told apart by eye. Hybrids are the problem, so it matters which characters separate the species and which are folklore.
| Character | Red mulberry | White mulberry | Worth? |
|---|---|---|---|
| Hairs on the leaf underside8910 | Erect hairs spread evenly over the whole blade — soft to the touch | Confined to the main veins and the tufts in vein axils | Best character |
| Leaf area810 | Blade 5–30 cm, typically 10–18 | Blade 2–20 cm, typically 8–10 — the full ranges overlap; the typical leaf is clearly smaller | Best measurable |
| Upper leaf surface810 | Roughened, dull green | Glossy, lustrous | Good |
| Marginal teeth810 | Small, numerous, pointed, consistent — the margin is regularly serrated | Fewer, larger, blunt, often irregular | Good, underused |
| Leaf apex810 | Drawn out to a long point | Acute to blunt | Suggestive |
| Bark texture910 | Flat thin plates peeling outwards | Firm braided ridges, orange showing in the furrows | Suggestive |
| Petiole upper side22 | Rounded (terete) or slightly flattened | Shallow lengthwise groove | Suggestive, single source |
| Petiole length810 | Overlapping; if anything M. alba is longer | Useless | |
| Style length10 | Both have a very short style or none (under 1 mm) | Useless | |
| Male vs female trees910 | Both subdioecious; ~10% hermaphrodite, and individuals switch between years | Useless | |
| Fruit colour89 | Overlapping and non-diagnostic — white mulberry is usually red to black, not white | Useless | |
Compiled from the Flora of North America treatment,8 Nepal, Mayfield & Ferguson 2012,9 and Nepal 2008,10 cited per row. Blade sizes: full ranges are Nepal 2008 (M. rubra 5–30 × 3–22 cm, M. alba 2–20 × 1.5–18 cm; Nepal 2012 extends M. rubra to 40 cm); "typically" is the Flora of North America (10–18, exceptionally to 36 cm, against (6–)8–10 cm). Teeth: Nepal 2008 gives M. rubra margins as "regularly serrated" with acute serrations, M. alba teeth as blunt and "often irregularly" cut. The petiole groove appears only in Weakley's Flora22 — no other flora used here mentions petiole cross-section, hence the single-source flag. published
The character to learn is where the hairs sit on the underside, not whether there are hairs. Red mulberry carries erect hairs spread across the whole blade, soft to the touch. White mulberry has them only along the ribs and in the little tufts where veins meet the midrib.
Three things widely believed that are not true
Fruit colour means nothing. Nepal and colleagues put it bluntly: fruit colour is "highly variable within M. alba and non-diagnostic. In fact, in wild populations, fruits of M. alba are usually red to black rather than white."9 The Flora of North America gives white mulberry syncarps as "black, purple, or nearly white."8 This belief causes more confident misidentifications than any other.
Style length is not diagnostic. This one circulates widely in identification guides. Both species have a very short style or none (under 1 mm in Nepal's treatment), so style length does not separate them. His genus-wide key places M. alba and M. rubra together in the short-or-absent-style half of the genus.10 What older sources call "style length" is a measurement of the stigma arms, and even that is contested.
Whether a tree is male, female or both is not a reliable species character. Both species are subdioecious, with roughly one tree in ten bearing both sexes,9 and a similar fraction switching sex from one year to the next.10 Treating breeding system as a species character produced a spurious mulberry species, M. murrayana, which was later dismissed on the same observation.9
Bark colour is not settled. The Michigan abstract calls red mulberry bark "dark-reddish brown",2 while the Flora of North America, the Canadian status report and Nepal all describe it as grey to greyish-tan and put the orange tint on white mulberry, showing in the furrows between firm ridges and on exposed roots.8129 The sources agree on texture (flat peeling plates against firm braided ridges), so use that and ignore the colour. unresolved
One more caution applies to almost everything in the table: these characters are read from mature leaves on ordinary shoots. Juvenile growth, stump sprouts and vigorous water shoots converge between the species, and as Nepal puts it, "nearly all of the unique characteristics of M. rubra fail in juvenile leaves."9
Konza Prairie, KansasField calls against markers · 2008
File 03 · Why the witness liesMorphology sees species. It barely sees ancestry
Burgess and colleagues measured six morphological characters alongside their genetic markers, and the pure and hybrid classes differed on all six.1 That result is less useful for field identification than it sounds.
The problem is which classes the characters separate. Only leaf area and leaf perimeter told all three groups apart. On the other four (number of lobes, sinus depth, and trichome density on both leaf surfaces), white mulberry and the hybrids were statistically indistinguishable from each other, and both differed from red mulberry.1
That helps one job and hurts another. Morphology is a decent way to find trees that are not red mulberry, which is what a removal programme needs. It does little to show that a good-looking tree is pure, because the hybrids that most resemble red mulberry are the ones the characters fail on.
Field calls and marker panels did not line up
The clearest example comes from a Kansas population studied by Nepal.10 Trees were assigned in the field to red mulberry, white mulberry or possible hybrid on leaf, bud and bark characters. Subsets were then run through a 49-band RAPD analysis and three microsatellite loci. Neither marker set agreed with the field calls, or with each other.
| Marker analysis | Trees field-assigned to a parental species that fell in its intermediate-ancestry range |
|---|---|
| Microsatellites | 10 — nine field-called red mulberry, one white |
| RAPD markers | 9 — five field-called red mulberry, four white |
These are candidate hybrids, not confirmed ones. The study had no validated pure-parent panel and no known crosses. The intermediate-ancestry range was also set from the average scores of the morphologically assigned parental trees, so morphology helped define the yardstick it was checked against. The result shows that field morphology and two small marker panels gave substantially different answers. It does not measure how often morphology was wrong.10
Conservation practice already reflects this. Canada's recovery strategy designates critical habitat for trees "confirmed as pure-strain Red Mulberry trees through genetic testing," and lists confirming the genetic purity of morphologically-identified trees as outstanding work.13 The status report records the consequence: "a few of trees previously counted as Red Mulberry were determined to be hybrids and were excluded from subsequent surveys."12
Of everything measurable on a leaf, hair density on the underside is the best single predictor of a tree's genetic ancestry. On its own it explains about 30% of the variation in hybrid index. In a combined regression of the four characters that individually tracked hybrid index, it was the only one that stayed significant, and the model reached 40%.1 That makes it a good morphological character, but not a test.
Settling the question takes a molecular test, and the next file covers what decides which one.
On paperInheritance and backcross arithmetic
File 04 · The ceilingTwo things decide what a test can possibly see
Price and convenience matter less than two facts about a marker: how it is inherited, and how many generations of backcrossing have happened. Together they rule out whole categories of test before you spend a dollar.
One: a maternal marker can only ever name one parent
In most flowering plants, chloroplasts are inherited from the mother: a tree's chloroplasts came from the ovule, not the pollen. Burgess and colleagues used this to read the maternal lineage of each hybrid from mulberry chloroplast DNA.1 It makes chloroplast DNA an excellent species marker and a limited hybrid marker.
If white mulberry pollen fertilises a red mulberry flower, the seedling is a 50/50 nuclear hybrid with a pure red mulberry chloroplast. Any chloroplast test will call that tree red mulberry. That describes about a third of the hybrids Burgess found, with a 95% interval from 17% to 52%; the interval is wide because the result rests on 25 sequenced trees, and its 68:32 split could not be distinguished from an even one.1 computed here A better chloroplast assay cannot recover those trees, because the information is not in the molecule.
A chloroplast test works well in the other direction. A tree that looks like red mulberry but has a white mulberry chloroplast is not pure, and one PCR shows it. (PCR, the polymerase chain reaction, is a routine lab method that makes millions of copies of a target stretch of DNA; here, the stretch that differs between red and white mulberry.) Most of the hybrids Burgess sequenced had a white-type chloroplast, so this catches most of them, but the small sample cannot say how many it misses.
Because the chloroplast is maternal and does not recombine, a chloroplast type belongs to a maternal lineage, not to an individual. A red-type chloroplast means the female line traces back to red mulberry. It tells you the immediate mother's species only if she was herself unadmixed. Every seedling of one mother carries her chloroplast, so testing a second seedling tells you nothing new.
For a set of related trees, such as a seed lot, a batch of nursery stock or a stand of root suckers, the chloroplast assay counts mothers, not stems. One test per maternal family gives all the available information, and recording which seed came from which tree is worth more than a better assay. Where lineage is unknown and material has been mixed, the assay becomes useful again: it estimates what fraction of the mix has white-type maternal lineages.
Two: detection decays by half with every backcross
Closing the maternal blind spot needs a marker inherited from both parents. A biparental marker has its own limit, and that limit comes from arithmetic.
At a locus where the two species are fixed for different variants, a first-generation hybrid carries one copy of each. It is heterozygous and detectable with certainty at a single locus. Backcross that hybrid to white mulberry, and each offspring has a one-in-two chance of inheriting the red variant at that locus. Backcross again and the chance is one in four. With n independent fixed-difference markers, the chance that a first backcross looks pure is 0.5n.
| Fixed-difference markers | First-generation hybrid | First backcross | Second backcross | Third backcross |
|---|---|---|---|---|
| 1 | 0% | 50% | 75% | 88% |
| 10 | 0% | 0.1% | 5.6% | 26% |
| 20 | 0% | 0.0001% | 0.3% | 6.9% |
| 50 | 0% | negligible | 0.00006% | 0.13% |
The first column is the one people miss. In principle, a single biparental fixed difference detects every first-generation hybrid, because an F1 inherits one copy from each parent and must carry both variants. What one locus cannot do is see deep backcrosses. Ten markers catch first-generation hybrids and first backcrosses. Fifty make it unlikely that anything within three generations is missed. Thousands, which sequencing provides, let you estimate the ancestry fraction instead of answering yes or no.
That table assumes an idealised single-copy locus: two alleles per individual, fixed between the species, both amplifying equally, both visible in the readout. Real markers break these assumptions in specific ways, and each failure moves a tree from the left of the table towards the right.
This matters because the nuclear marker this page recommends is ITS (the internal transcribed spacer of the ribosomal RNA genes), which is not single-copy. It is a tandem array of hundreds to thousands of repeats, and a PCR returns a pooled and possibly biased sample of them. An F1 is expected to show both parental repeat classes. A class can still be under-represented through copy-number differences between the parents, primer mismatch, competition during amplification, or partial homogenisation of the array. The guarantee in the first column comes from the genetics; it has not been measured for this assay. Where this page says a marker "detects every F1", it means detects every F1 whose minority repeat class amplifies above the detection threshold.
Because real markers rarely meet the ideal assumptions, the practical guidance asks for many of them. A simulation study by Vähä and Primmer concluded that efficient detection of first-generation hybrids needs 12 to 24 markers, and that "separating backcrosses from purebred parental individuals requires a considerable genotyping effort (at least 48 loci), even when divergence between parental populations is high."6
Every method handles F1s well, but the wild hybrids Burgess sampled were not mostly F1s. Their mean hybrid index was 0.46, below the 0.5 an F1 would give, and 67% of them carried more white mulberry genome than red.1 The authors concluded that "some of the hybrids are not F1 crosses; rather they are later generation backcrosses that contain high proportions of M. alba genome."
The history fits. White mulberry arrived in the early 1600s, and mulberry generations are short (under about 15 years), so there has been time for backcrossing. Burgess inferred that at least some of the hybrids were later-generation backcrosses, but the study did not measure what fraction fell in each class. A one-locus screen is strongest against F1s and weakest against deep backcrosses, so wherever backcrosses are present it will miss some.
A one-locus screen is still useful. A verified pure mother pollinated by white mulberry produces F1s, so in a controlled setting the F1 is the common case. For a wild tree of unknown pedigree, expect some deep backcrosses among the trees you screen, and treat a clean result with that in mind.
The rest of this page judges each method on those two limits.
No test can prove a tree carries no white mulberry ancestry; you cannot rule out a single introgressed gene many generations back. On this page “pure” is shorthand for something narrower: indistinguishable from a red mulberry reference at the resolution of the method you ran.
So every “pure”, “clear” and “certify” below depends on three things: the reference trees you compared against, the markers you used, and the confidence you required. A tree that reads as pure on a two-marker gel may not on a genome scan. Ancestry after repeated backcrossing is a gradient, not two categories, and this page tries to say how far down that gradient a given test can see.
The published recordSearched through August 2026
File 05 · The auditWhat already exists, and why none is yet a validated panel
The obvious move is to find the published marker panel for this species pair and use it. I found several partial precedents and no finished one. Because "no panel exists" is easy to say and easy to get wrong, this file sets out what I checked.
A marker set is ancestry-informative for this problem if it has been validated against three things at once: geographically representative M. rubra reference material, equivalent M. alba reference material, and known hybrids of known generation (F1s, reciprocal F1s and backcrosses). Without the third, you cannot measure the two numbers that matter: how often the panel calls a real hybrid pure, and how often it calls a pure tree admixed.
Several of the efforts below are good work. None of them meets that standard.
The foundational study used markers that don't transfer between labs
Burgess and colleagues' 2005 paper is still the reference measurement for mulberry hybridisation, and it is the source of the 53.7% figure. The nuclear markers were RAPDs (randomly amplified polymorphic DNA), read alongside chloroplast sequence.1 RAPDs are dominant, so a heterozygote looks the same as a homozygote for the present allele. They are also anonymous, meaning the bands are not tied to known sequence, and they are sensitive to reaction conditions, so results generally do not transfer between laboratories. The study stands as a published measurement. The paper gives its five primers and reaction conditions, but for the same reproducibility reason it is not a protocol you can pick up and rely on.
Its numbers set the resolution of the best measurement available. They screened 100 RAPD primers and kept five. Those yielded nine species-diagnostic fragments (five for white mulberry, four for red) plus 34 that were polymorphic but not diagnostic, for 43 scored in total.1 The hybrid classifications came from a maximum-likelihood index built on all 43 fragments, not the nine alone. Because these are dominant, anonymous markers never tested on known crosses, their sensitivity does not follow from the ideal single-locus arithmetic in File 04. The reference sets were cleanly separated: the red set averaged 0.89 on the index (95% interval 0.79–0.93) and the white 0.09 (0.05–0.20). The means fall short of 1 and 0 because most fragments are polymorphic rather than fixed, and the index is a probability.1
The microsatellite work exists, and was not designed for this question
There are two relevant efforts. Nepal's 2008 dissertation ran both microsatellites and RAPDs on a Kansas population. This is the analysis behind File 03, where ten trees field-assigned to a parental species landed in the intermediate-ancestry range.10 The more recent one is Schreier and Nepal's survey of 78 trees across six Upper Midwest populations, posted to bioRxiv in July 2026 and not yet peer reviewed.20 preprint They screened 12 markers originally developed in Asian Morus: M. indica (which their paper treats as synonymous with M. alba, although Kew currently accepts it as distinct) and M. boninensis. Five amplified cleanly in M. rubra and were used for the analysis.
Markers that amplify in both species can still tell them apart. Microsatellites are scored by allele size, not by whether they amplify, so to compare two species at a locus the primers generally have to work in both. Diagnostic power comes from how the allele-size distributions differ, how strongly the parental populations are differentiated, and how many loci you combine. Cross-species transferability makes a locus testable in both species; it does not disqualify it.
The limitation is narrower, and the authors state it themselves. The study was designed as an M. rubra population survey, and its limitations section names "the absence of reference M. alba and confirmed hybrid genotypes," concluding that "additional highly informative nuclear markers are therefore needed to resolve the extent, directionality, and demographic consequences of introgression."20 Whether those five loci are ancestry-informative is therefore unmeasured, because the design could not measure it.
Where individuals showed extra allelic peaks, the pattern that looks most like introgression, the authors decline to call it: such profiles "do not independently demonstrate allopolyploidy or introgression from M. alba," and what is needed is "species-diagnostic nuclear SNPs or genome-scale data."20
There is one possible risk. Observed heterozygosity was below expected at every locus in every population (a mean of 0.34 against 0.65), and the authors list null alleles and allele dropout among the possible causes.20 If a primer silently fails on one species' allele, a heterozygous hybrid can read as a homozygous pure tree. A heterozygote deficit does not establish this on its own: inbreeding, population subdivision (the Wahlund effect) and sampling structure produce the same signature, and the authors name those too. The dataset contained no confirmed hybrids, so nothing in it shows dropout turning hybrids into pure calls. It is a failure mode to test for with known crosses, not an observed outcome.
The older result is more telling. Nepal's two analyses agreed on only eight candidate hybrids — eight of 18 from microsatellites, eight of 17 from RAPDs.10 The classifications depended heavily on the marker set. Because neither panel was validated against known parents and hybrids, the study cannot say which list was more accurate, or how reliable either is.
Two operational efforts, neither publicly specified
Canada runs the most extensive red mulberry identification programme. Leaf samples go to the University of Guelph Arboretum for genetic testing to call each tree red, white or hybrid, and the recovery strategy designates critical habitat only for trees "confirmed as pure-strain Red Mulberry trees through genetic testing."13 The programme excludes trees from surveys on the strength of its calls.12 But neither the recovery strategy nor the Arboretum's published material names the markers, the loci or the technique. not disclosed in any source I could find
Separately, a US SARE-funded citizen-science project, Red Mulberry Search and Rescue, collected over 100 leaf samples nationally. It had DNA extracted at the Ohio University Genomics Facility and worked with Los Alamos National Laboratory to begin building an M. rubra genome to compare samples against the existing M. alba one.21 It reports classifying samples as rubra, alba or hybrid "with a high degree of accuracy", and states the limitation itself: because no complete rubra genome existed, "the results are not necessarily indicative of complete purity of species."21 This is a genome-comparison approach rather than a marker panel, and its classifier is not published in a form anyone can rerun.
Neither of these is a criticism. A conservation programme has no obligation to publish a protocol, and a farmer-grant project has no obligation to release a classifier. It does mean a third party cannot pick up either of the two most-used methods for this question.
The most useful thing to look for, then, is a fixed difference: a position where every red mulberry carries one variant and every white mulberry another, tied to known sequence so anyone can check it, and readable without specialist equipment. The rest of this page derives two, one maternal and one biparental. Neither has been validated against known crosses either, and the page flags that where it matters.
Brookings, South Dakota45 chloroplast genomes · eight states · 2025
File 06 · Building a markerWhere the two genomes differ
Finding a fixed difference used to mean a sequencing project. Enough Morus sequence is now public that the marker can be found from existing data, and anyone can repeat the analysis.
In 2025 a group at South Dakota State University published complete chloroplast genomes for 45 mulberry trees collected across eight US states, deposited as GenBank accessions PQ309062–PQ309106.3 That dataset shows directly which stretch of DNA to use.
I downloaded all 45 and analysed them. computed here
Aligning a red mulberry genome (159,423 bp) against a white mulberry one (159,293 bp) gives 421 single-base differences and 696 insertion or deletion events. The largest indel is 36 bp, and most of the ten largest are tandem-repeat expansions (a short motif repeated one extra time). Repeats like these expand and contract on their own and are prone to assembly error, so they make unreliable species markers.
So there is no large, clean length difference that would show up by running a PCR product straight onto a gel. The dependable signal is in substitutions, which have to be either sequenced or cut with an enzyme.
Which region carries the signal
For each candidate region I counted positions where all 33 unambiguous red mulberries were fixed for one base and all 10 unambiguous white mulberries fixed for another.
| Region | Fixed differences | of which substitutions | Verdict |
|---|---|---|---|
| rpl32–trnL(UAG) | 131 | 14 | The one to use |
| ycf1 | 93 | 24 | Strong but unwieldy |
| ndhF–rpl32 | 68 | 22 | Strong |
| psbE–petL | 51 | 14 | Good |
| trnS–trnG | 36 | 11 | Usable |
| psbA–trnH | 10 | 2 | Too weak |
| trnL–trnF | 8 | 2 | Too weak |
| rbcL (standard barcode) | 5 | 5 | Works, barely |
| matK (standard barcode) | 4 | 4 | Works, barely |
computed here from GenBank PQ309062–PQ309106.
Two results stand out. First, the standard plant barcodes work: rbcL and matK carry five and four fixed differences. That is unusual for two species in the same genus, so a conventional barcoding workflow can be used here. With only four or five informative positions, though, one sequencing error costs you a quarter of your evidence.
Burgess used one of these. Their chloroplast work sequenced an 802 bp window of rbcL and found the two species differing at three fixed sites, with no variation within either species.1 Three sites across 42 trees was enough to call maternal lineage, and it is consistent with the five this analysis finds across the whole gene. rbcL works, but rpl32–trnL carries roughly forty times more signal, which is enough to read with a restriction digest instead of a sequencing run.
Second, rpl32–trnL(UAG) is far ahead at 131 fixed differences. It separated all 43 unambiguous trees: every red mulberry scored 131 out of 131 red-type positions, and every white mulberry 131 out of 131 white-type, with no intermediates.
Two limits apply. “Unambiguous” means the 43 of the 45 whose plastome agrees with their GenBank label. The discordant remainder, labelled one species but carrying the other's plastome, is set aside and discussed in File 07, so the clean separation of all 43 applies only to the accessions that were kept. And the trees come from eight states, not the whole range, so the 131 positions are fixed in the genomes sampled here. They are strong candidate diagnostics, not differences proven fixed across either species everywhere.
NCBI, Bethesda, MarylandRefSeq NC_070233
File 07 · Two false leadsThe marker that wasn't, and the reference that misleads
A perfect 69 bp marker, which does not exist
Early in the analysis a different region looked ideal. The spacer between rps15 and ycf1 came out at 333 bp in every white mulberry and 405–407 bp in every red mulberry: a 70 bp gap, easy to read on a gel with no enzyme.
The difference is an annotation artifact. The ycf1 gene is annotated as starting 69 bp further along in the white mulberry records than in the red mulberry ones, so the same DNA falls inside the gene in one set of records and inside the spacer in the other. Comparing "spacer lengths" compares two different things. Searching all 199 Morus chloroplast genomes in GenBank for the supposedly red-mulberry-specific 69 bp block found it in every one, including all 101 white mulberries. computed here
This mistake is easy to make and hard to see. Check any length difference derived from annotation coordinates against the sequence itself.
The NCBI red mulberry reference carries a white-type plastome
Scored against the diagnostic positions it comes out 12 white-type to 2 red-type. Its length, 159,289 bp, matches white mulberry (159,293 bp), not the red mulberry range of 159,396–159,423 bp. GenBank records it as identical to accession OP161259.4 The authors of the 2025 study also noticed that this accession falls among the Asian species in their phylogeny.3 computed here
This does not show that the source tree was misidentified. As File 04 explains, a plastome reports maternal lineage, not nuclear ancestry. The source could be a largely M. rubra tree that carries a white mulberry chloroplast through introgression, which is common: most of the hybrids Burgess sequenced carried the white type. What can be said is that the record is taxonomically discordant.
Either way, anyone comparing a sample against "the M. rubra reference genome" is comparing it against a white mulberry–type plastome and will get the wrong answer. Use the vouchered PQ309073–PQ309106 series instead.
The same check found the reverse case. Accession PQ309072, deposited as M. alba, carries a plastome that is red-type at 131 of 131 positions: a tree identified as white mulberry whose maternal line was red. computed here This is the two-way introgression Burgess described, turning up by chance in a modern dataset, and it shows clearly that a plastome names a maternal lineage, not a species.
GenBank holds 249 nucleotide records for M. rubra against 5,097 for M. alba. computed here Some red mulberry records carry white mulberry–type sequence and some white mulberry records carry red, as you would expect from two species that hybridise freely. A label records what the collector identified; an organellar sequence records only the maternal line. Before you compare your tree against a reference, check the reference.
University of Central MissouriHybrid specimen KANU:361918 · 2010
File 08 · The two assaysOne PCR, one enzyme, one gel
The 131 fixed differences in rpl32–trnL(UAG) can be read by sequencing. They can also be read for a few dollars with a restriction enzyme, because some of those differences create or destroy an enzyme's recognition site.
I searched the amplicon (the stretch of DNA the PCR copies) for enzymes whose number of cuts differs consistently between the species, then computed the predicted fragments for all 43 unambiguous trees. One enzyme works especially well.
HpyCH4III
Across those 43 trees, red mulberry carries one cut site in the amplicon and white mulberry carries three. computed here The two patterns look different at a glance, so you do not need to measure band sizes carefully.
Red mulberry gives one heavy band high on the gel. White mulberry gives a band slightly below it plus an obvious small band near the bottom. A hybrid shows the pattern of its maternal line, so the test reports maternal chloroplast lineage and nothing else.
If HpyCH4III is hard to source, HinfI (cheaper, more widely stocked) separates the two with a busier pattern: red mulberry shows bands near 228 and 168 bp where white shows a single ~425 bp band. SspI and BfaI also work. computed here
The second assay: a biparental marker
The chloroplast assay has the first limit from File 04: it cannot see the third of hybrids that carry a red-type chloroplast. Closing that gap needs a locus inherited from both parents, and there is one you can run in the same afternoon from the same DNA extraction.
ITS sits in the nuclear genome, so a tree inherits it from both parents. If the two species carry different ITS variants, a hybrid carries both, and both show on a gel. This is the codominant signal that the arithmetic in File 04 calls for. A first-generation hybrid must carry both variants, so in principle this one locus flags all of them, subject to the multicopy caveat in File 04.
I downloaded every full-length Morus ITS sequence from GenBank (90 labelled M. rubra and 90 labelled M. alba) and aligned them. computed here The species differ at 22 near-fixed positions, and one of them creates a restriction site.
The amplicon uses the universal ITS1 and ITS4 primers published by White and colleagues in 1990,16 which are among the most widely used ITS primers across plants and fungi, and match the Morus sequences. verified against the sequences The enzyme is NEB MboI, R0147S, 500 units for $88.00. confirmed
ITS1 TCCGTAGGTGAACCTGCGG
ITS4 TCCTCCGCTTATTGATATGC
Both parental variants have been recovered from a real hybrid
A prediction alone is weak evidence. A group at the University of Central Missouri ran a relevant experiment in 2010, and the data are in GenBank. They support the prediction, with one limit set out below.
They took a herbarium-vouchered M. alba × M. rubra hybrid — specimen KANU:361918 — cloned its ITS, and sequenced four clones from that one tree.17 I downloaded all four and scored them at my diagnostic site. computed here
| Clone from the one hybrid tree | MboI sites | Reads as | Submitters' own annotation |
|---|---|---|---|
| HQ144170 · clone 1 | 2 | white mulberry type | "Morus alba haplotype" |
| HQ144171 · clone 2 | 2 | white mulberry type | "Morus alba haplotype" |
| HQ144175 · clone 3 | 1 | red mulberry type | "Morus rubra haplotype" |
| HQ144187 · clone 4 | 1 | red mulberry type | "Morus rubra haplotype" |
I scored their pure reference trees too: all eight red mulberry clones carry one MboI site, and all three white mulberry clones carry two. computed here
Those four sequences came from cloning: the ITS product was split into individual molecules, and each was sequenced separately. Nobody has taken bulk PCR product from a hybrid, cut it with MboI, and shown that all three predicted bands are visible on a gel.
That difference matters. Cloning recovers a repeat class at any abundance; a digest shows it only if there is enough to make a visible band. A hybrid whose red-type repeats were partly outcompeted during amplification could sequence as mixed and still run as a clean white mulberry pattern. So this result establishes the biology (a vouchered hybrid carries both parental ITS variants at this site) and leaves the assay's sensitivity unmeasured.
A second variant at the same locus, from a published study
While checking this, I found a second polymorphism at the same locus. A 2025 paper in Plants genotyped 542 mulberry accessions across the ribosomal region, recovering 158 SNPs and 15 indels, and built a CAPS marker (a PCR-and-enzyme test like the ones here) on a 13 bp insertion in ITS1.18 In my downloaded set that insertion is present in red mulberry and absent in white. It creates an MstI site. FspI is an isoschizomer that recognises the same TGCGCA sequence and is more commonly stocked, so order that one.
That paper supports less than it might seem to. Its CAPS assay was built to separate M. alba and M. notabilis from other Morus species, a taxonomic question, using BstEII and MstI. It was not a red-versus-white hybrid test, it did not use FspI, and it did not measure whether the assay detects mixed parental repeat classes in an F1 or a backcross.18 It does show that the locus carries scoreable variation and that a restriction assay on it works at the bench.
Scored against my downloaded set, the insertion is present in 88 of 88 clean red mulberry sequences and 1 of 90 white mulberry. computed here The ITS region therefore carries two diagnostic variants, at different positions, each readable with its own enzyme.
Running both does not mean a hybrid has to slip past two independent markers. The MboI site and the 13 bp indel sit in the same nuclear ribosomal repeat. They are physically linked, travel together in the same tandem array, and share nearly every way this assay can fail: concerted evolution, unequal repeat abundance between the parents, preferential amplification of one repeat class, or a minority class falling below the detection threshold.
Anything that hides one variant will tend to hide the other in the same tree. Running both gives you two observations of one locus. That is a useful check against a bad digest or a misread gel, but the errors are correlated, so it does not add confidence the way two independent loci would. Independent confirmation has to come from elsewhere in the genome.
That paper also publishes mulberry-specific ITS primers. If you are ordering new primers, use those instead of the universal ones.
ITS sits in hundreds of tandem copies, and concerted evolution can homogenise those copies over generations, erasing the hybrid signal. If that happens, the test fails on older hybrids.
In Morus, homogenisation is incomplete. The 2025 survey of 542 accessions concluded that the "widespread occurrences of heterogeneous SNPs and InDels" indicate "incomplete concerted evolution of nrDNA". Cloning recovered 26 distinct ITS sequences from 32 clones of a single tree, and 15 to 26 unique sequences per plant in the others.18 A separate study found polymorphic ITS types in 14 of 33 accessions.19 The four cloned molecules show that the hybrid above still carried both parental repeat classes, though not how abundant each was. I found no published case of concerted evolution erasing this red/white distinction, but that absence proves little.
This is reassuring, but it guarantees nothing for a particular tree several generations into backcrossing. Treat a clean result as a provisional negative (no mixed ITS repeat class detected), not as proof of purity. How strong that negative is will stay unknown until known hybrids are tested.
Geographically, Morus celtidifolia, the Texas or mountain mulberry of the southwestern US and Mexico, shares the red-mulberry-type insertion. computed here Within the eastern range of M. rubra the two barely overlap, but in the Southwest do not assume this test separates them.
The GenBank check also turned up the same labelling problem as the chloroplast data. Two of the 90 sequences deposited as M. rubra carry pure white mulberry ITS at every diagnostic position. computed here They are OR251260 and FJ605516, the same two the literature search had already flagged.
The protocol
- Collect and dry
Young, fully expanded sun leaves. Dry them immediately in silica gel at roughly ten times the tissue mass. This step matters more than any other: properly dried tissue yields good DNA for years at room temperature, and a leaf left in a warm bag overnight may yield none. Photograph the tree, the bark and both leaf surfaces, and take a GPS point.
- Extract DNA
A silica-column plant kit, or CTAB if you prefer to mix your own. Mulberry leaves are high in polysaccharides and phenolics, so add PVP to a CTAB prep or use a kit with an inhibitor-removal step. A generic animal-tissue kit usually gives poor results.
- Amplify rpl32–trnL(UAG)
Use the published universal primers from Shaw and colleagues.5 I checked both against the Morus sequences. computed here
rpL32-F CAGTTCCAAAAAAACGTACTTC
One mismatch to Morus, which reads…CCG…where the primer has…CCA…. It sits at position 8, far from the 3′ end, and will amplify normally.trnL(UAG) CTGCTTCCTAAGAGCAGCGT
Exact match in both species.Expect roughly 1,800 bp. Run 5 µL on a gel to confirm a single clean product before digesting.
- Amplify ITS as well
Same DNA, second tube, primers
ITS1andITS4. Expect roughly 700 bp. Running both loci from one extraction costs one extra tube and gives you the nuclear result alongside the maternal one. - Digest
Take 10 µL of each product, add buffer and about 5 units of enzyme (HpyCH4III for the chloroplast amplicon, MboI for the ITS amplicon), and hold at 37 °C for an hour. Both enzymes work at the same temperature, so they can share a water bath. Unpurified product straight from the PCR usually digests well enough for a yes/no readout, but leftover PCR components can inhibit the enzyme. NEB recommends cleaning the product up first; if a digest looks incomplete, dilute or purify it and repeat.
- Run and read
Run a 1.5% agarose gel with a 100 bp ladder, a known white mulberry as a positive control, and a no-template (water) reaction to catch contamination. White mulberry is everywhere; take one from a hedgerow and confirm the assay works on it before you trust it on anything rare. Also run an uncut aliquot of each PCR product beside its digest, because a failed or partial digest can pass for a genotype. This matters most for the ITS assay: uncut ~700 bp product runs almost where a fully cut red mulberry band does, so an under-digested white or hybrid can read as pure red.
Read the two lanes together. The chloroplast lane names the maternal chloroplast lineage. The ITS lane says whether both species are represented in the nuclear genome. Three bands in the ITS lane mean both parental types are present: the hybrid signal.
These are candidate screens with sequence-level support, not validated diagnostic tests.
What is solid. The sequence differences. The chloroplast marker holds across 43 independently sequenced genomes with no exceptions. The ITS marker separates 178 sequences correctly, and both parental variants have been recovered at the diagnostic site from a vouchered hybrid.
What is not. Every fragment size on this page is predicted computationally, and I have not run either digest at a bench. unverified as a bench protocol More importantly, neither has been run against known crosses (F1s, reciprocal F1s, backcrosses). That is the only way to measure the two numbers that decide whether a screen is any good: how often it misses a hybrid, and how often it flags a pure tree. Both numbers are unknown for both assays. The published CAPS work at the ITS locus18 shows that a restriction assay there works at the bench, but it was built for species-level taxonomy and never measured hybrid sensitivity.
Treat your first runs as a test of the method, not of the trees; that is what the white mulberry control is for. Every confidence figure later on this page depends on a sensitivity nobody has measured.
The benchPrices confirmed 2 August 2026
File 09 · Doing it yourselfWhat the bench costs
You can buy both assays as a service (see the next file), so you don't need your own equipment. Owning it pays off if you expect to run many samples: the cost per tree falls to a few dollars and results take an afternoon instead of weeks. This section lists what it costs.
Twenty years ago this work needed a university facility. Now it needs four appliances and a shoebox of reagents. Nothing below requires a licence, an institution, or a laboratory address.
| Item | Why | Options & price |
|---|---|---|
| Thermocycler | Runs the PCR by cycling temperature. This is the one instrument you can't do without. | miniPCR mini8X $695 / mini16X $835; sold to individuals, runs off a laptop.15 A used Bio-Rad or Eppendorf on eBay goes for a fraction. used price unverified |
| Gel rig + viewer | Separates the cut fragments by size so you can read the pattern. | blueGel $309 — tank, power supply and blue-light transilluminator in one.15 Cycler + gel together as the DNA Discovery System, $950–$1,099. |
| 37 °C holder | For the enzyme digest; you also want 65 °C for extraction. | Cozy Cube $199, or a kitchen sous-vide circulator ($0 if you own one) — both hold 37 °C fine. |
| Micropipettes + tips | Measure 1–20 µL accurately; nothing in a kitchen does this. | Three miniPCR H-style $59 each ($177), or Edvotek $95 (lifetime warranty); tips $42 for three 96-racks. Research-grade three-packs run $1,130–$1,380 — not needed here. |
| HpyCH4III enzyme | Cuts the chloroplast amplicon; its site AC^NGT is the diagnostic site. | NEB R0618S, 250 U $83, rCutSmart buffer — 5 U per digest, so 50 trees.14 |
| MboI enzyme | Cuts the ITS amplicon; can show a hybrid outright (site GATC, 37 °C). | NEB R0147S, 500 U $88.14 Sau3AI or DpnII cut the same site. |
| HinfI enzyme optional | Alternative to HpyCH4III — busier pattern, far more units for the money. | NEB R0155S, 5,000 U $77. |
| PCR master mix | 2× mix. You add only water, primers and template, which avoids most first-PCR mistakes. | NEB OneTaq M0482S, $53 / 100 reactions. |
| Four primers | Two pairs — chloroplast and ITS (sequences in the protocol). One order lasts years. | Eurofins $0.42/base, 25 nmol desalted — about $9.24 per 22-mer, ~$37 for all four. price unverified |
| Plant DNA extraction | Mulberry phenolics and polysaccharides inhibit PCR, so a generic animal-tissue kit won't work well. | Column kits: Zymo D6020 $273/50, Qiagen 69104 $326 or 69204 $359. Cheap start: miniPCR X-Tract crude lysate $22/20 — often enough for a multicopy target. Home CTAB + PVP also works. |
| 100 bp ladder | The size reference you read the gel against. | NEB N3231S $71/100 lanes; cheaper if you shop — GoldBio ReadyLadder $49, miniPCR load-ready $66. |
| Gel chemistry | Agarose, buffer, stain. Use GelRed, GelGreen or SYBR with a blue-light viewer — never ethidium bromide under UV. | All-in-one agarose tabs (buffer + stain included) $19/8 gels. Separately: agarose $46, TBE $7.50, GelRed $34, loading dye $30. |
| Silica gel desiccant | Dries the leaves. It is the cheapest item here, and the one that most decides whether anything else works. | Fine 0.5–1.5 mm non-indicating beads: 55 lb drum $79 (~$3.18/kg). Avoid the 3–5 mm flower-drying beads — too little contact area. |
A working bench, everything new: about $1,600.
| Line | Choice | Cost |
|---|---|---|
| Thermocycler + gel rig | miniPCR DNA Discovery System | $950 |
| Pipettes + tips | Three miniPCR H-style, one rack each | $219 |
| Both enzymes | HpyCH4III + MboI | $171 |
| PCR master mix | OneTaq, 100 reactions | $53 |
| Four primers | Eurofins, 25 nmol desalted | $37 |
| DNA extraction | X-Tract buffer, 20 preps | $22 |
| Gels | All-in-one agarose tabs, 8 | $19 |
| Ladder | GoldBio ReadyLadder | $49 |
| Silica gel | 55 lb drum | $79 |
| Total | $1,599 |
With a used thermocycler and gel rig it comes to about $800. With a column extraction kit and research-grade pipettes it passes $2,500. The machines account for most of the cost.
After setup, running both tests costs a few dollars per tree.
Before buying anything
Consider two cheaper routes first.
Community biology labs own all of this and let members run their own projects. Verified monthly rates: BosLab, Somerville MA — $50; SoundBio, Seattle — $55, or $135 to lead your own project; ChiTownBio, Chicago — $75; Counter Culture Labs, Oakland — $100; BUGSS, Baltimore — $100; Genspace, Brooklyn — $110 community, $220 for full project access. confirmed Most ask for a short project proposal and a safety session.
Counter Culture Labs suits this project best. It runs a standing plant biology group, and its fungal group already does ITS extraction and sequencing, which is the second assay on this page.
Or send the reading out. If you sequence the amplicon instead of digesting it, you read all 131 chloroplast positions instead of the few one enzyme sees. Psomagen charges $3.50 a reaction; Quintara from $4.00; Eurofins SimpleSeq prepaid kits work out at $6.10; Plasmidsaurus sequences an unpurified amplicon for $15 and takes a credit card with no minimum. confirmed Azenta/GENEWIZ confirms in its own FAQ that individuals can register and pay by card, though it publishes no price.
Sending samples for sequencing doesn't remove the need for equipment. Every service in that price band sequences a prepared template, meaning a PCR product or a plasmid. None of them takes raw mulberry genomic DNA and returns the chloroplast region you want; the $15 Plasmidsaurus tier wants a linear amplicon, and SimpleSeq and Psomagen's standard Sanger service both assume you supply the product.
So you still extract DNA, amplify the target on a thermocycler, check on a gel for one clean product, often clean it up, and supply a sequencing primer. The 1,800 bp chloroplast amplicon is longer than one Sanger read, so it needs a read from each end: budget two reactions per tree. The ~700 bp ITS amplicon fits in a single read.
Sequencing replaces the restriction digest and the gel readout: no enzymes, no ladder, no transilluminator, and far more information per tree. You only skip the bench entirely if someone else does your PCR, such as a community lab, a university core, or a collaborator.
So the comparison is the thermocycler plus a few dollars a read, against the thermocycler plus the gel rig plus enzymes. At three to fifteen dollars a read, sequencing gives more information per tree and takes longer. It saves the $309 gel rig and the $171 of enzymes, not the whole $1,599.
None of this work is dangerous. Keep the DNA stain off your skin and out of the drain, and always run a known control beside any sample you care about. The most common result of a first attempt is a blank gel, which tells you nothing and uses up a sample.
Five routesFree to $1,000 a tree
File 10 · Choosing a routeWhat each method resolves
This table puts the methods side by side. Cost and resolution don't rise together: the cheapest useful step is nearly free, and most of the cost goes on the last bit of certainty.
| Method | Cost per tree | Detects | Blind to |
|---|---|---|---|
| Leaf hairs, by eye | free | Most pure red mulberry vs everything else | Hybrids, which resemble white mulberry |
| Chloroplast digest rpl32–trnL, HpyCH4III | ~$3 | White-type maternal lineages — most hybrids, on a small sample | Any hybrid with a red-type chloroplast — a third, perhaps half |
| ITS digest MboI, biparental | ~$3 | F1s, and about half of first backcrosses | Deep backcrosses; any repeat class below the detection threshold |
| Sanger, both loci | $7 – $60 plus PCR | Same, plus all 131 chloroplast positions and the exact ITS variants | Same generation limit — more sites, still one locus each |
| Genome skimming | $225 – $1,000 | Ancestry fraction and hybrid index; generation class with enough depth | Very late backcrosses; limited by reference quality, mapping bias and depth |
Per-tree costs assume you can already run a PCR; see File 09 for what a bench costs to build, and note that the Sanger row does not remove that requirement — those services sequence a prepared amplicon, so the thermocycler is needed either way. The chloroplast amplicon needs a read from each end at 1,800 bp, hence two reactions. Vendor prices verified below; the Sanger figures are unverified beyond the two checked by hand.
The two gel assays answer a different question from sequencing; they aren't a cheaper version of it. The chloroplast assay rejects trees. The ITS assay targets the first-generation hybrid. Neither can catch a tree several generations into backcrossing, with a red-type chloroplast, homogenised ITS, and a quarter of its genome still from white mulberry.
The table has no sensitivity figure for each row, and that gap matters most. Nobody has measured how often these assays miss a hybrid, because that needs known crosses, and (per File 05) nobody has assembled that reference set for this species pair. The "detects" column describes what each method is designed to reach, not a measured hit rate. See File 11 before attaching a confidence number to any of it.
For a deeply backcrossed tree, or if you need an ancestry estimate rather than a yes/no flag, use the last row.
When you need genome-wide ancestry: genome skimming
Send extracted DNA for low-coverage whole-genome sequencing. At one or two times coverage you recover the complete chloroplast genome as a byproduct, because it is present in thousands of copies per cell. You also get nuclear variants that can place the tree on a triangle plot of hybrid index against heterozygosity, which separates first-generation hybrids from backcrosses and from pure trees. Placing a tree confidently on that plot, especially on the heterozygosity axis, takes considerably more coverage than recovering the chloroplast.7 One experiment can answer both questions, with no wet-lab marker panel to build. It still needs genotypes called at many ancestry-informative sites for each tree, and a trustworthy set of pure-parent references to define those sites. As File 05 found, no validated reference set exists yet for this species pair.
Prices: Plasmidsaurus publishes $250 for 1 Gb, $500 for 5 Gb, $1,000 for 15 Gb, and lists plants among the organisms the service covers. confirmed The $250 tier is specified for genomes of 20–60 Mb. A 340 Mb mulberry genome falls in the 300–750 Mb band, which is the $1,000 tier. A gigabase against 340 Mb is about 3× coverage and would probably support a hybrid index, but it isn't the configuration they sell for a genome that size.
The hard part is getting the DNA. Plasmidsaurus does not accept any intact tissues or organs from animals, plants, insects, fungi, etc.
confirmed A leaf in an envelope is refused. Plant material is taken only as protoplasts with the cell walls stripped, or as high-molecular-weight genomic DNA you extracted yourself — RNase-treated, and never touched by phenol or chloroform.
SeqCenter has the same requirement. It posts nanopore ligation prices openly: $150 for 300 Mb, $175 for 600 Mb, $225 for 1.2 Gb, library prep included confirmed. There is no quote request and no institutional account, and it is cheaper per gigabase than the tiers above. But it wants 60 µL at 40 ng/µL of clean double-stranded DNA, and its own extraction service covers only certain microbes.
So you can buy the sequencing cheaply from a web page. Turning a mulberry leaf into a tube of sequenceable DNA is the step that still needs a lab bench, or a core facility willing to do the extraction for you.
There is no red mulberry nuclear genome assembly. NCBI lists zero assemblies and six sequencing runs for the species, against four assemblies for white mulberry. computed here Nuclear reads therefore have to be mapped to the white mulberry reference, which works for ancestry estimation but introduces a mild bias and needs someone experienced to do it.
Two groups are working on this. Schreier and Nepal state in their preprint that low-coverage genome-skimming data already exist for the species and that development of a high-quality nuclear reference genome is underway using PacBio long-read and Hi-C scaffolding data
, alongside complete chloroplast and mitochondrial genomes from which hundreds of candidate organellar markers are undergoing validation
.20 preprint Separately, the SARE citizen-science project has been working with Los Alamos National Laboratory towards an M. rubra assembly for the same purpose.21 Anyone starting this work now should check whether either has landed before mapping to white mulberry.
A test that costs a few dollars and rules out most hybrids is still worth running: it turns a guess into a shortlist. Send the trees that pass for sequencing.
Any stand, seed lot or nursery batch1 − (1 − p)n
File 11 · How manyHow many trees to test
The number of trees you test sets the cost of a screening programme. It depends on whether you are trying to find hybrids or to show there are none, and the second takes far more testing.
Suppose you are looking at a group that should be red mulberry — a stand, a seed lot, a batch of planting stock — and some unknown fraction p of it is admixed. If you test n individuals, the chance of catching at least one hybrid is 1 − (1 − p)n.
| Tested | p = 50% | p = 30% | p = 20% | p = 10% | p = 5% |
|---|---|---|---|---|---|
| 3 | 87.5% | 65.7% | 48.8% | 27.1% | 14.3% |
| 5 | 96.9% | 83.2% | 67.2% | 41.0% | 22.6% |
| 10 | 99.9% | 97.2% | 89.3% | 65.1% | 40.1% |
| 20 | 100% | 99.9% | 98.8% | 87.8% | 64.2% |
| 30 | 100% | 100% | 99.9% | 95.8% | 78.5% |
| 60 | 100% | 100% | 100% | 99.8% | 95.4% |
The left-hand column is roughly what Burgess measured — 98 of 184 trees, in populations that had been sought out because they held red mulberry.1 Canada's recovery strategy repeats the same 53.7% figure for its core populations.13 That is almost certainly the same measurement, not an independent one, but it is the number the recovery programme plans around. At that rate, five tests find a hybrid 97 times in 100.
Two cautions on borrowing that number, both from the authors. The sampling took every putative red mulberry but only about a quarter of the surrounding white and hybrid trees, so they warn the figure "is an overestimate of the frequency of hybrids (and underestimate of whites)".1 Pulling the other way, it counts only hybrids that survived to be sampled — "hybridization rates for Morus may be even higher at the time of fertilization."1 So treat 50% as a working figure for a stand where both species grow together. It is not a measured constant, and it doesn't transfer to a stand you haven't sampled.
If all n come back clean, you have only an upper bound on the hybrid fraction, and it falls slowly as n grows.
| Individuals tested | 5 | 10 | 20 | 30 | 60 | 100 |
|---|---|---|---|---|---|---|
| Upper bound | 45% | 26% | 14% | 9.5% | 4.9% | 3.0% |
Those figures assume every hybrid among the trees you sampled is flagged. These assays don't do that. Write the assay's sensitivity as s — the probability that a genuinely admixed tree comes back positive — and the detection formula becomes 1 − (1 − p·s)n. Everything in the first table shifts right, and everything in the second bounds only p·s, not p.
s is well below 1, for known reasons. The chloroplast assay misses every hybrid with a red-type chloroplast — a third of them on the best estimate, and up to half at the edge of the confidence interval. The ITS assay misses deep backcrosses by the arithmetic in File 04, and may miss some recent ones through repeat-class bias. Nobody has measured s for either assay, because that needs known crosses, the validation File 05 found missing. Until someone does, these tables bound the frequency of hybrids your test can see. They say nothing rigorous about the true hybrid fraction.
Both formulas also assume the n trees are independent draws. Siblings from one mother are not independent — they share her chloroplast entirely, and half her nuclear genome. Neither are root suckers, which may be one clone, or trees clustered in one thicket. Twenty stems from one maternal family are far fewer than twenty independent observations; the effective sample size can be a small fraction of the stem count. Spread sampling across mothers and across space, or discount n accordingly.
So design the programme to reject trees. Test a handful from any group you suspect and act on the first positive. Save the expensive genome-wide methods for the few trees that pass screening and that you plan to collect seed from, protect, or propagate.
Report what the result supports. No method on this page can show that this stock is pure red mulberry
. A supportable statement looks like this: mother tree chloroplast red-type, both ITS variants red-type, twenty offspring screened with no hybrids detected by an assay of unmeasured sensitivity — so the detectable hybrid fraction is under 14% at 95% confidence. That is a weaker claim, and it is what the evidence supports.
Your state natural heritage programAfter the result
File 12 · AfterwardsWhat to do with a result
Voucher everything. A genetic result is only useful as evidence if it is tied to a GPS point, a set of photographs and a pressed specimen. You can deposit herbarium sheets with a regional herbarium; most welcome material from a documented wild population.
Consider sending samples onward. Madhav Nepal's group at South Dakota State University generated the 45-genome dataset this page is built on, works directly on red mulberry hybridisation,3 and has recently posted a population-genetic survey of 78 red mulberries across Kansas, Iowa, Wisconsin and Nebraska as a preprint.20 Their sampling is concentrated in the central US; the eastern and southeastern parts of the range look thin. Tissue from an unsampled population would fill a gap in their data.
If a population comes back clean, tell your state natural heritage program, whether or not red mulberry is formally listed where you are.
The words, in one place
Each term is defined where it first appears. They are collected here for reference.
| Trichome | A plant hair. Where the hairs sit on the leaf underside is the best single field character. |
| Syncarp | The compound mulberry fruit: many tiny fruits fused into one. |
| Allele | One of the alternative versions of the sequence at a locus. |
| Locus | One location in the genome. Two variants close together in the same stretch are not two independent tests. |
| SNP / indel | The two commonest kinds of DNA difference: a single-letter change (SNP), or a short insertion or deletion (indel). |
| Heterozygous / homozygous | Carrying two different versions at a locus, or two copies of the same one. |
| Fixed difference | A position where every sampled member of one species reads one way and every sampled member of the other reads another. Fixed in the sample is not proof it holds everywhere. |
| Introgression | DNA from one species left behind in another after hybrids repeatedly breed back into one parent. |
| Backcross | A hybrid breeding with one of its parent species. Each round roughly halves the other species' share of the genome. |
| F1 | The direct offspring of one red and one white parent, not any hybrid. |
| Hybrid index | An estimate of how much of a tree's ancestry comes from each parent species, scaled from one to the other. Not a probability that the tree is a hybrid. |
| Plastome / chloroplast type | The chloroplast's DNA, inherited here from the seed parent, so it names the maternal lineage, not the whole tree's ancestry. |
| Biparental | Inherited from both parents, as nuclear DNA is, unlike the maternal-only chloroplast. |
| ITS (nrDNA array) | A nuclear region present in hundreds to thousands of repeated copies, so one tree can carry several versions at once. |
| Concerted evolution | Processes that slowly make those repeated copies more alike, which can erase a hybrid signal over generations. |
| RAPD | Randomly amplified polymorphic DNA: an early, anonymous fingerprinting marker. It is dominant and sensitive to reaction conditions, so results rarely transfer between labs. |
| Microsatellite | A short repeated DNA motif whose copy number varies between individuals; scored by length, and highly variable. |
| Dominant / codominant | A dominant marker (like RAPD) can't tell a heterozygote from a homozygote; a codominant one (like ITS here) shows both versions at once. |
| Allele dropout | When one version at a locus fails to amplify, so a heterozygote reads as homozygous and a hybrid can read as pure. |
| PCR | Polymerase chain reaction: a lab method that makes millions of copies of a target stretch of DNA. |
| Amplicon | The stretch of DNA a PCR copies. |
| Restriction digest / CAPS | Cutting a PCR product with an enzyme that only cuts where a specific short sequence occurs, giving a band pattern that shows which variant is present. |
| Agarose gel | The jelly-like slab a digest is run on; an electric field pulls the DNA fragments through it and sorts them by size. |
| Sanger sequencing | Reads the exact base sequence of one amplicon; a hybrid shows overlapping peaks at a diagnostic position. |
| Genome skimming | Shallow whole-genome sequencing that reads many fragments a little, rather than assembling a full genome. |
| Sensitivity / specificity | Of real hybrids, the fraction a test catches (sensitivity); of real non-hybrids, the fraction it correctly leaves alone (specificity). |
References
- Burgess, K. S., Morgan, M., Deverno, L. & Husband, B. C. (2005). Asymmetrical introgression between two Morus species (M. alba, M. rubra) that differ in abundance. Molecular Ecology 14: 3471–3483. pubmed.ncbi.nlm.nih.gov/16156816
- Penskar, M. R. (2009). Special Plant Abstract for Morus rubra (red mulberry). Michigan Natural Features Inventory, Lansing, MI. mnfi.anr.msu.edu
- Adhikari, B., Parajuli, S. & Nepal, M. P. (2025). Reporting complete chloroplast genome of endangered red mulberry, useful for understanding hybridization and phylogenetic relationships. Scientific Reports. GenBank PQ309062–PQ309106. pmc.ncbi.nlm.nih.gov/articles/PMC12008415
- Zeng, Q., Chen, M., Wang, S., Xu, X., Li, T., Xiang, Z. & He, N. (2022). Comparative and phylogenetic analyses of the chloroplast genome. Frontiers in Plant Science 13: 1047592. Source of accession OP161259, from which RefSeq NC_070233 is derived. ncbi.nlm.nih.gov/nuccore/NC_070233
- Shaw, J., Lickey, E. B., Schilling, E. E. & Small, R. L. (2007). Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: the tortoise and the hare III. American Journal of Botany 94: 275–288. Source of the rpL32-F and trnL(UAG) primers. doi.org/10.3732/ajb.94.3.275
- Vähä, J.-P. & Primmer, C. R. (2006). Efficiency of model-based Bayesian methods for detecting hybrid individuals under different hybridization scenarios and with different numbers of loci. Molecular Ecology 15: 63–72. pubmed.ncbi.nlm.nih.gov/16367830
- Wiens, B. J. & Colella, J. P. (2025). triangulaR: an R package for identifying AIMs and building triangle plots using SNP data from hybrid zones. Heredity. nature.com/articles/s41437-025-00760-2
- Wunderlin, R. P. (1997). Moraceae: Morus. In Flora of North America North of Mexico, vol. 3. Oxford University Press. efloras.org — genus key, M. rubra, M. alba
- Nepal, M. P., Mayfield, M. H. & Ferguson, C. J. (2012). Identification of eastern North American Morus: taxonomic status of M. murrayana. Phytoneuron 2012-26: 1–6. The clearest published character comparison, and the source of the statement that fruit colour is non-diagnostic. phytoneuron.net (PDF)
- Nepal, M. P. (2008). Systematics and reproductive biology of the genus Morus L. (Moraceae). PhD dissertation (not peer-reviewed), Kansas State University. Source of the Konza Prairie comparison of field morphology with RAPD and microsatellite classifications. krex.k-state.edu
- Burgess, K. S. (2004). The genetic and demographic consequences of hybridization in small plant populations. PhD thesis, University of Guelph. The fuller analysis behind Burgess et al. 2005; listed for further reading. atrium.lib.uoguelph.ca
- COSEWIC (2014). Assessment and Status Report on the Red Mulberry Morus rubra in Canada. Listed under COSEWIC assessments on the species page. Species at Risk Public Registry — Red Mulberry
- Parks Canada Agency (2013). Recovery Strategy for the Red Mulberry (Morus rubra) in Canada. Species at Risk Act Recovery Strategy Series. Listed under Recovery strategies on the same species page. Species at Risk Public Registry — Red Mulberry
- New England Biolabs product catalogue, prices confirmed 2 August 2026: HpyCH4III R0618S, HinfI R0155S, OneTaq 2X Master Mix M0482S, 100 bp DNA Ladder N3231S
- miniPCR bio (Amplyus LLC) store, prices confirmed 2 August 2026. minipcr.com/store
- White, T. J., Bruns, T., Lee, S. & Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications, pp. 315–322. Academic Press. The source of the ITS1 and ITS4 primers, now used across plants as well as fungi. doi.org/10.1016/B978-0-12-372180-8.50042-1
- Nikaido, S., Salah, S. M., Ely, J. S., Wolf, H. J. & Raveill, J. A. (2010). Mulberry (Morus: Moraceae) hybridization in eastern North America: morphological and molecular evidence. University of Central Missouri. Unpublished; data deposited as GenBank HQ144170–HQ144187, including four cloned ITS sequences from the vouchered hybrid KANU:361918. ncbi.nlm.nih.gov/nuccore/HQ144170
- Xu, X., Zhang, L., Bi, C., Qin, M., Wang, S., Li, D., He, N. & Zeng, Q. (2025). Extensive nrDNA polymorphism in Morus L. and its application. Plants 14(16): 2570, published 18 August 2025. Open access. 158 SNPs and 15 indels across 542 accessions. Source of the 13 bp ITS1 indel and of the evidence that concerted evolution in Morus is incomplete. Its CAPS assay uses BstEII and MstI and was built to separate M. alba and M. notabilis from other Morus species — a taxonomic discrimination, not a red–white hybrid test. doi.org/10.3390/plants14162570
- Xuan, Y., Wu, Y., Li, P., Liu, R., Luo, Y., Yuan, J., Xiang, Z. & He, N. (2019). Molecular phylogeny of mulberries reconstructed from ITS and two cpDNA sequences. PeerJ 7: e8158. doi.org/10.7717/peerj.8158
- Schreier, S. J. & Nepal, M. P. (2026). Population genetics of native red mulberry at its northwestern boundary suggests postglacial founder effects. bioRxiv preprint, posted 14 July 2026, not certified by peer review. 78 M. rubra individuals across six populations in Kansas, Iowa, Wisconsin and Nebraska. doi.org/10.64898/2026.07.11.737963
- Cornett, J. (2022–2024). Red Mulberry Search and Rescue: preserving genetic diversity for the future of sustainable agroforestry. USDA SARE Farmer/Rancher grant FNC22-1338. Citizen-collected leaf samples, extraction at the Ohio University Genomics Facility, genome comparison against M. alba with Los Alamos National Laboratory. Reports rubra / alba / hybrid calls but states the results are "not necessarily indicative of complete purity of species." projects.sare.org/sare_project/fnc22-1338
- Weakley, A. S. & the Southeastern Flora Team (2026). Flora of the Southeastern United States. University of North Carolina Herbarium (NCU), North Carolina Botanical Garden. The only source found that records the petiole cross-section contrast: M. alba "petioles with shallow groove on upper side", M. rubra "petioles terete or slightly flattened on upper side". fsus.ncbg.unc.edu